Bio Sequences: Tm, Translation, Alignment and Digests

Bio Sequences is a five-panel workbench for DNA, RNA and protein sequences: Sequence & Tm for composition, mass and melting temperature; Translation & ORF for six-frame translation and open reading frames; Protein for physicochemical properties; Alignment for pairwise global and local alignment; and Restriction for sites and virtual digests. One cleaned sequence feeds all five, each panel has its own address, and every calculation runs locally.

Updated 2026-10-01Reviewed by CalcX Editorial Team6 sources5 min read

How to use it

Provide the sequence.Paste raw bases or a FASTA record; headers, whitespace and digits are skipped, invalid characters are reported, and IUPAC codes (N, R, Y, S) are accepted where the model supports them.
Pick a panelfrom the tab strip or open its address; the sequence persists across panels.
Declare the model:molecule and 5′ end for mass; genetic code table 1, 2, 3 or 11; salt and primer concentration for Tm; matrix and gap costs; linear or circular topology.
Read and copy:cards, tables and text blocks hold the reverse complement, peptide, alignment or fragments.
Compare before trusting:side-by-side models flag disagreement, and the Tm spread card turns red past 8 °C.

Worked readouts

All values come from the demos the panels load; only the ORF threshold was changed.

Panel	Input	Readout
Sequence & Tm	87 nt demo, dsDNA, 5′-OH, 50 mM Na⁺, 500 nM primer	87 nt · GC 55.17% · 53637.78 Da · ΔG°₃₇ -94.88 kcal/mol
Sequence & Tm	primer `ATGGCCATTGTAATGGGCCG`	NN Tm 58.4 °C · GC rule 53.8 °C · Wallace 62 °C · spread 8.2 °C
Translation & ORF	demo, table 1, threshold ≥ 20 aa then ≥ 5 aa	frame +1 reads `MAIVMGRKGARLRDRSASLGAIPG` (29 aa, 5 stops); 0 ORFs at ≥ 20 aa; at ≥ 5 aa: +3 21–59* (12 aa, CTG/TAG) and +1 1–24 (7 aa, ATG/TGA)
Protein	75 aa demo	pI 8.51 · 8.799 kDa · GRAVY -0.004 · instability 34.21 (stable) · +1.67 at pH 7
Alignment	HEAGAWGHEE / PAWHEAE, BLOSUM50, open 8, extend 8	global score 1, identity 45.5% (5/11); local score 28 on `AWGHE` / `AW-HE`
Restriction	87 nt demo, six default enzymes, linear	3 cuts → 4 fragments · largest 71 bp (81.6%) · single cutters EcoRI, HindIII, SmaI

The demo's frames are full of stops, so nothing reaches the default 20 aa minimum; at 5 aa the finder returns two ORFs.

One sequence, five models

The panels share an input, not an algorithm. Sequence & Tm counts bases and applies three melting models, each with a validity label; translation expands IUPAC codons and reports ambiguous ones as X; protein uses EMBOSS pKa and Kyte–Doolittle scales; alignment scores residue pairs from the chosen matrix; restriction scans IUPAC sites and reports overhangs. Every model is named, and its settings are inputs rather than hidden defaults.

Limits to keep in mind

Calibrated ranges.: Nearest-neighbour Tm expects 10–1000 mM salt and warns below 8 nt; the Wallace and GC rules are length-limited; GRAVY and the instability index are calibrated on full proteins; masses are average, not monoisotopic.
Input alphabet and size caps.: Panels accept A/C/G/T where the model requires it — nearest-neighbour Tm refuses ambiguous bases — and alignment stops above 4,000,000 DP cells (about 2,000 × 2,000 residues). The digest scans the 32 common enzymes in its reference table.
What it does not do.: No multiple-sequence alignment, database search, primer design or plasmid annotation; this is a pairwise bench calculator. For a GenBank search or a multi-sequence tree, use NCBI BLAST or Clustal Omega.

The three Tm cards do not agree

The signature trap sits on the first panel: three Tm values that look interchangeable. For the primer ATGGCCATTGTAATGGGCCG they read 58.4 °C (nearest neighbour), 53.8 °C (GC rule) and 62 °C (Wallace), a spread of 8.2 °C. On the 87 nt demo the same cards read 79.0 °C, 79.8 °C and 270 °C — a spread of 191.0 °C printed in red. Wallace counts only base composition, 2(A+T) + 4(G+C); the GC rule adds an average correction; only the nearest-neighbour value carries stacking, salt and primer concentration. Design with the nearest-neighbour card; treat the other two as rules of thumb that expire outside their length window.

Where it helps

Ordering a primer

Paste the candidate 20-mer: GC 55.00%, NN Tm 58.4 °C at 50 mM Na⁺ and 500 nM, a mass of 12235.05 Da double-stranded (6173.07 Da single-stranded) and 4086.62 pmol/mL per OD₂₆₀ unit.

Checking a construct

Frame +1 reads the demo as MAIVMGR*KGAR*…, the ORF finder recovers the CTG-led 12 aa peptide at 21–59, and the Restriction panel turns the same input into 3 cuts → 4 fragments.

Sorting out a protein prep

pI 8.51, GRAVY -0.004 and 8.799 kDa across 75 residues, with ε₂₈₀ 8,480 M⁻¹cm⁻¹ and A₂₈₀ at 1 g/L of 0.964 — enough to pick a buffer pH and read concentration from an absorbance.

References

SantaLucia J., A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, PNAS 95(4):1460–1465 (1998), pubmed.ncbi.nlm.nih.gov （访问日期：2026-10-01）— nearest-neighbour Tm parameters and salt correction.
NCBI, Genetic Codes, ncbi.nlm.nih.gov （访问日期：2026-10-01）— translation tables 1/2/3/11.
Henikoff S. & Henikoff J.G., Amino acid substitution matrices from protein blocks, PNAS 89(22):10915–10919 (1992), pubmed.ncbi.nlm.nih.gov （访问日期：2026-10-01）— BLOSUM matrices for alignment.
Kyte J. & Doolittle R.F., A simple method for displaying the hydropathic character of a protein, J Mol Biol 157(1):105–132 (1982), doi.org （访问日期：2026-10-01）— the GRAVY hydropathy scale.
Pace C.N. et al., How to measure and predict the molar absorption coefficient of a protein, Protein Sci 4(11):2411–2423 (1995), pubmed.ncbi.nlm.nih.gov （访问日期：2026-10-01）— 280 nm extinction coefficients.
REBASE, The Restriction Enzyme Database, rebase.neb.com （访问日期：2026-10-01）— recognition sites and cut positions.